u/Zektre

Hey, I just wanted to share the interesting variants I get when inputting all of the genes into gene.iobio.

I took 1/8 of a 5 mg pill of fin in May 2025. Stopped because I started noticing some minor penile burning later the same day. Three days later I crashed.

I’ve grouped the VCF variants separately from the BAM variants. The variants are in the same order that gene.iobio prioritized them in the UI.

I ran the patched WAR_POWERS script from u/Excellent-Push2833 to find gene deletions, but no hits were found (deletion_hits.tsv was empty).

VCF variants:

Gene: DGAT2
Consequence: Missense
Variant: c.1034C>T
Protein: p.Pro345Leu
rsID: rs138423103
Zygosity: Het
Ref Allele: C
Alt Allele: T
Freq: 0.0184% rare (popmax 0.0294%)
REVEL: 0.446
Source coordinates: chr11:75800375-75800376
ClinVar: uncertain significance

Gene: TET1
Consequence: Missense
Variant: c.5422G>A
Protein: p.Val1808Met
rsID: rs150708897
Zygosity: Het
Ref Allele: G
Alt Allele: A
Freq: 0.0893% rare (popmax 0.207%)
REVEL: 0.028
Source coordinates: chr10:68690825-68690826
ClinVar: likely benign

Gene: TPH1
Consequence: Missense
Variant: c.529G>A
Protein: p.Val177Ile
rsID: rs147638867
Zygosity: Het
Ref Allele: C
Alt Allele: T
Freq: 0.236% uncommon (popmax 0.406%)
REVEL: 0.419
Source coordinates: chr11:18029303-18029304
ClinVar: likely benign

Gene: UGT2B15
Consequence: Missense
Variant: c.1408C>T
Protein: p.Arg470Cys
rsID: rs147164238
Zygosity: Het
Ref Allele: G
Alt Allele: A
Freq: 0.324% uncommon (popmax 0.579%)
REVEL: 0.505
Source coordinates: chr4:68647289-68647290
ClinVar: likely benign

Gene: CUBN
Consequence: Missense
Variant: c.6469A>G
Protein: p.Asn2157Asp
rsID: rs144360241
Zygosity: Het
Ref Allele: T
Alt Allele: C
Freq: 0.526% uncommon (popmax 0.647%)
REVEL: 0.322
Source coordinates: chr10:16925418-16925419
ClinVar: benign/likely benign

Gene: CUBN
Consequence: Missense
Variant: c.3604G>T
Protein: p.Ala1202Ser
rsID: rs141740096
Zygosity: Het
Ref Allele: C
Alt Allele: A
Freq: 0.0368% rare (popmax 0.104%)
REVEL: 0.053
Source coordinates: chr10:17045075-17045076
ClinVar: conflicting classifications of pathogenicity

Gene: CHD7
Consequence: Missense
Variant: c.307T>A
Protein: p.Ser103Thr
rsID: rs41272435
Zygosity: Het
Ref Allele: T
Alt Allele: A
Freq: 1.303% common (popmax 1.909%)
REVEL: 0.063
Source coordinates: chr8:60741739-60741740
ClinVar: benign/likely benign

Gene: TBP
Consequence: Inframe deletion
Variant: c.279_281del
Protein: p.Gln95del
rsID: rs752404282
Zygosity: Het
Ref Allele: ACAG
Alt Allele: A
Freq: 0.403% uncommon (popmax 0.513%)
REVEL: not shown
Source coordinates: chr6:170561958-170561961
ClinVar: benign

Gene: TBP
Consequence: Inframe deletion
Variant: c.273_281del
Protein: p.Gln93_Gln95del
rsID: rs752404282
Zygosity: Het
Ref Allele: ACAGCAGCAG
Alt Allele: A
Freq: 0.0411% rare (popmax 0.203%)
REVEL: not shown
Source coordinates: chr6:170561958-170561967
ClinVar: benign

Gene: CYP1A1
Consequence: Missense
Variant: c.1390C>A
Protein: p.Arg464Ser
rsID: rs41279188
Zygosity: Het
Ref Allele: G
Alt Allele: T
Freq: 0.453% uncommon (popmax 0.813%)
REVEL: 0.518
Source coordinates: chr15:74720638-74720639
ClinVar: benign

Gene: SLC16A9
Consequence: Missense
Variant: c.1501T>G
Protein: p.Phe501Val
rsID: rs138607526
Zygosity: Het
Ref Allele: A
Alt Allele: C
Freq: 0.785% uncommon (popmax 1.388%)
REVEL: 0.111
Source coordinates: chr10:59652801-59652802
ClinVar: benign

Gene: NCOR1
Consequence: Missense
Variant: c.4218A>C
Protein: p.Leu1406Phe
rsID: rs61753150
Zygosity: Het
Ref Allele: T
Alt Allele: G
Freq: 0.968% uncommon (popmax 1.508%)
REVEL: 0.160
Source coordinates: chr17:16070460-16070461
ClinVar: benign

Gene: MTHFR
Consequence: Missense
Variant: c.1958C>T
Protein: p.Thr653Met
rsID: rs35737219
Zygosity: Het
Ref Allele: G
Alt Allele: A
Freq: 1.41% common (popmax 2.2%)
REVEL: 0.139
Source coordinates: chr1:11790693-11790694
ClinVar: benign

Gene: MC4R
Consequence: Missense
Variant: c.307G>A
Protein: p.Val103Ile
rsID: rs2229616
Zygosity: Het
Ref Allele: C
Alt Allele: T
Freq: 1.543% common (popmax 2.43%)
REVEL: 0.050
Source coordinates: chr18:60372043-60372044
ClinVar: benign

Gene: MT-ATP6
Consequence: Missense
Variant: c.334A>G
Protein: p.Thr112Ala
rsID: rs2001031
Zygosity: Hom
Ref Allele: A
Alt Allele: G
Freq: not shown
REVEL: not shown
Source coordinates: chrMT:8860-8861
ClinVar: benign

Gene: MT-ATP6
Consequence: Missense
Variant: c.529G>A
Protein: p.Ala177Thr
rsID: rs193303045
Zygosity: Hom
Ref Allele: G
Alt Allele: A
Freq: not shown
REVEL: not shown
Source coordinates: chrMT:9055-9056
ClinVar: benign

Gene: MT-CYB
Consequence: Missense
Variant: c.580A>G
Protein: p.Thr194Ala
rsID: rs2853508
Zygosity: Hom
Ref Allele: A
Alt Allele: G
Freq: not shown
REVEL: not shown
Source coordinates: chrMT:15326-15327
ClinVar: benign

Gene: EHMT1
Consequence: Splice acceptor in non-canonical transcripts
Variant: c.843A>T
Protein: p.Leu281Phe
rsID: rs1485591700
Zygosity: Het
Ref Allele: A
Alt Allele: T
Freq: 0.00156% very rare (popmax 0.00329%)
REVEL: 0.074
Source coordinates: chr9:137743390-137743391
ClinVar: not shown

Gene: EP400
Consequence: Inframe insertion
Variant: c.8189_8190insACAGCAGCAGCA
Protein: p.Gln2745_Gln2748dup
rsID: rs1555223311
Zygosity: Het
Ref Allele: A
Alt Allele: ACAGCAGCAACAG
Freq: 0.0142% rare (popmax 0.0194%)
REVEL: not shown
Source coordinates: chr12:132062548-132062560
ClinVar: not shown

Gene: DRD4
Consequence: Missense
Variant: c.812G>C
Protein: p.Arg271Pro
rsID: rs767239460
Zygosity: Het
Ref Allele: G
Alt Allele: C
Freq: 0.0685% rare (popmax 0.0924%)
REVEL: 0.054
Source coordinates: chr11:640061-640062
ClinVar: not shown

Gene: DRD4
Consequence: Missense
Variant: c.850A>C
Protein: p.Ser284Arg
rsID: rs34662058
Zygosity: Het
Ref Allele: A
Alt Allele: C
Freq: 0.0572% rare (popmax 0.439%)
REVEL: 0.043
Source coordinates: chr11:640099-640100
ClinVar: not shown

Gene: NDUFS2
Consequence: Missense
Variant: c.968G>A
Protein: p.Arg323Gln
rsID: rs35086265
Zygosity: Het
Ref Allele: G
Alt Allele: A
Freq: 0.463% uncommon (popmax 0.943%)
REVEL: 0.525
Source coordinates: chr1:161210692-161210693
ClinVar: conflicting classifications of pathogenicity

Gene: EHMT2
Consequence: Missense
Variant: c.173C>T
Protein: p.Ser58Phe
rsID: rs115884658
Zygosity: Het
Ref Allele: G
Alt Allele: A
Freq: 1.205% common (popmax 1.948%)
REVEL: 0.085
Source coordinates: chr6:31896761-31896762
ClinVar: not shown

BAM variants:

Gene: KDM6A
Consequence: Splice donor variant
Variant: c.3300+1G>A
Protein: not shown
rsID: rs1602928572
Zygosity: Het
Ref Allele: G
Alt Allele: A
Freq: not shown
REVEL: not shown
Quality: Poor evidence of alternate allele
Read support: 2 ALT / 19 REF (depth 21; BAM depth 16)
Source coordinates: chrX:45079352-45079353
ClinVar: likely pathogenic

Gene: CHD3
Consequence: Missense in non-canonical transcripts
Variant: not shown
Protein: not shown
rsID: not shown
Zygosity: Het
Ref Allele: G
Alt Allele: T
Freq: not shown
REVEL: not shown
Quality: Sufficient depth and allele counts
Read support: 4 ALT / 16 REF (depth 20; BAM depth 14)
Source coordinates: chr17:7884933-7884934
ClinVar: uncertain significance

Gene: ARID1B
Consequence: Inframe deletion
Variant: c.534_536del
Protein: p.His179del
rsID: rs754114025
Zygosity: Het
Ref Allele: CCCA
Alt Allele: C
Freq: 0.09465% rare (popmax 0.3077%)
REVEL: not shown
Quality: Sufficient depth and allele counts
Read support: 2 ALT / 16 REF (depth 18; BAM depth 27)
Source coordinates: chr6:156778198-156778201
ClinVar: benign/likely benign

Gene: KDM6B
Consequence: Splice acceptor variant
Variant: c.457-2A>C
Protein: not shown
rsID: rs1271434435
Zygosity: Het
Ref Allele: A
Alt Allele: C
Freq: 0.6599% uncommon (popmax 0.7769%)
REVEL: not shown
Quality: Sufficient depth and allele counts
Read support: 8 ALT / 33 REF (depth 41; BAM depth 34)
Source coordinates: chr17:7846398-7846399
ClinVar: not shown

Gene: SMARCA2
Consequence: Splice acceptor variant
Variant: c.3079-2A>C
Protein: not shown
rsID: not shown
Zygosity: Het
Ref Allele: A
Alt Allele: C
Freq: not shown
REVEL: not shown
Quality: Poor evidence of alternate allele
Read support: 2 ALT / 21 REF (depth 23; BAM depth 23)
Source coordinates: chr9:2101568-2101569
ClinVar: not shown

Gene: SETD2
Consequence: Stop gained
Variant: c.325C>T
Protein: p.Gln109Ter
rsID: not shown
Zygosity: Het
Ref Allele: G
Alt Allele: A
Freq: not shown
REVEL: not shown
Quality: Poor evidence of alternate allele
Read support: 2 ALT / 22 REF (depth 24; BAM depth 21)
Source coordinates: chr3:47124311-47124312
ClinVar: not shown

Gene: MED23
Consequence: Frameshift variant
Variant: c.2276dup
Protein: p.Asn759LysfsTer7
rsID: rs765921048
Zygosity: Het
Ref Allele: A
Alt Allele: AT
Freq: not shown
REVEL: not shown
Quality: Poor evidence of alternate allele
Read support: 3 ALT / 31 REF (depth 34; BAM depth 30)
Source coordinates: chr6:131598705-131598706
ClinVar: not shown

Gene: KDM5D
Consequence: Stop gained
Variant: c.1102C>T
Protein: p.Gln368Ter
rsID: not shown
Zygosity: Het
Ref Allele: G
Alt Allele: A
Freq: not shown
REVEL: not shown
Quality: Poor evidence of alternate allele
Read support: 2 ALT / 20 REF (depth 22; BAM depth 21)
Source coordinates: chrY:19732156-19732157
ClinVar: not shown

Gene: KDM5D
Consequence: Missense variant splice region variant
Variant: c.1090G>A
Protein: p.Ala364Thr
rsID: not shown
Zygosity: Het
Ref Allele: C
Alt Allele: T
Freq: not shown
REVEL: not shown
Quality: Sufficient depth and allele counts
Read support: 2 ALT / 16 REF (depth 18; BAM depth 15)
Source coordinates: chrY:19732586-19732587
ClinVar: not shown

Gene: KAT6A
Consequence: Missense variant
Variant: c.5090A>C
Protein: p.Gln1697Pro
rsID: rs750469825
Zygosity: Het
Ref Allele: T
Alt Allele: G
Freq: 0.02331% rare (popmax 0.0504%)
REVEL: 0.129
Quality: Sufficient depth and allele counts
Read support: 5 ALT / 26 REF (depth 31; BAM depth 24)
Source coordinates: chr8:41933130-41933131
ClinVar: not shown

Gene: TBP
Consequence: Protein altering variant
Variant: c.228_231delinsA
Protein: p.Gln95del
rsID: not shown
Zygosity: Het
Ref Allele: GCAG
Alt Allele: A
Freq: not shown
REVEL: not shown
Quality: Poor sequence depth
Read support: 4 ALT / 0 REF (depth 4; BAM depth 20)
Source coordinates: chr6:170561964-170561967
ClinVar: not shown

Gene: UGT2B7
Consequence: Missense variant
Variant: c.801_802delinsTC
Protein: p.Tyr268His
rsID: rs386675647
Zygosity: Hom
Ref Allele: AT
Alt Allele: TC
Freq: not shown
REVEL: not shown
Quality: Sufficient depth and allele counts
Read support: 29 ALT / 0 REF (depth 29; BAM depth 28)
Source coordinates: chr4:69098619-69098621
ClinVar: not shown

Gene: SETD1B
Consequence: Inframe deletion
Variant: c.3150_3191del
Protein: p.Ser1052_Ser1065del
rsID: not shown
Zygosity: Het
Ref Allele: TCATCATCCTCGGGGTCCTCAACCACCTCACCCTCGTCCTCGG
Alt Allele: T
Freq: not shown
REVEL: not shown
Quality: Sufficient depth and allele counts
Read support: 2 ALT / 18 REF (depth 20; BAM depth 31)
Source coordinates: chr12:121817540-121817582
ClinVar: not shown

Gene: NSD2
Consequence: Missense variant
Variant: c.63G>A
Protein: p.Met21Ile
rsID: not shown
Zygosity: Het
Ref Allele: G
Alt Allele: A
Freq: not shown
REVEL: 0.441
Quality: Poor evidence of alternate allele
Read support: 4 ALT / 42 REF (depth 46; BAM depth 40)
Source coordinates: chr4:1900717-1900718
ClinVar: not shown

Gene: NCOA3
Consequence: Missense variant
Variant: c.1709C>T
Protein: p.Pro570Leu
rsID: not shown
Zygosity: Het
Ref Allele: C
Alt Allele: T
Freq: not shown
REVEL: 0.211
Quality: Poor evidence of alternate allele
Read support: 2 ALT / 23 REF (depth 25; BAM depth 24)
Source coordinates: chr20:47636095-47636096
ClinVar: not shown

Gene: MYC
Consequence: Missense variant
Variant: c.454G>A
Protein: p.Gly152Ser
rsID: rs1248173307
Zygosity: Het
Ref Allele: G
Alt Allele: A
Freq: not shown
REVEL: 0.283
Quality: Poor evidence of alternate allele
Read support: 2 ALT / 22 REF (depth 24; BAM depth 19)
Source coordinates: chr8:127738671-127738672
ClinVar: not shown

Gene: MBD2
Consequence: Missense variant
Variant: c.374A>G
Protein: p.Glu125Gly
rsID: not shown
Zygosity: Het
Ref Allele: T
Alt Allele: C
Freq: not shown
REVEL: 0.394
Quality: Sufficient depth and allele counts
Read support: 5 ALT / 21 REF (depth 26; BAM depth 21)
Source coordinates: chr18:54224186-54224187
ClinVar: not shown

Gene: KCNQ4
Consequence: Missense variant
Variant: c.50A>G
Protein: p.Asp17Gly
rsID: not shown
Zygosity: Het
Ref Allele: A
Alt Allele: G
Freq: not shown
REVEL: 0.424
Quality: Sufficient depth and allele counts
Read support: 6 ALT / 29 REF (depth 35; BAM depth 29)
Source coordinates: chr1:40784143-40784144
ClinVar: not shown

Gene: KDM6A
Consequence: Missense variant
Variant: c.731C>T
Protein: p.Thr244Ile
rsID: not shown
Zygosity: Het
Ref Allele: C
Alt Allele: T
Freq: not shown
REVEL: 0.234
Quality: Poor evidence of alternate allele
Read support: 2 ALT / 20 REF (depth 22; BAM depth 17)
Source coordinates: chrX:45051785-45051786
ClinVar: not shown

Gene: HDAC8
Consequence: Missense variant
Variant: c.478C>A
Protein: p.Leu160Met
rsID: not shown
Zygosity: Het
Ref Allele: G
Alt Allele: T
Freq: not shown
REVEL: 0.642
Quality: Poor evidence of alternate allele
Read support: 2 ALT / 20 REF (depth 22; BAM depth 19)
Source coordinates: chrX:72495228-72495229
ClinVar: not shown

Gene: CYP2C19
Consequence: Missense variant
Variant: c.990_991inv
Protein: p.Ile331Val
rsID: rs1554854489
Zygosity: Het
Ref Allele: CA
Alt Allele: TG
Freq: not shown
REVEL: not shown
Quality: Sufficient depth and allele counts
Read support: 14 ALT / 0 REF (depth 14; BAM depth 24)
Source coordinates: chr10:94842865-94842867
ClinVar: not shown

Gene: AGO2
Consequence: Missense variant
Variant: c.10_11delinsAA
Protein: p.Gly4Lys
rsID: not shown
Zygosity: Het
Ref Allele: CC
Alt Allele: TT
Freq: not shown
REVEL: not shown
Quality: Sufficient depth and allele counts
Read support: 2 ALT / 11 REF (depth 13; BAM depth 11)
Source coordinates: chr8:140635496-140635498
ClinVar: not shown

Gene: AGO1
Consequence: Missense variant
Variant: c.163T>A
Protein: p.Tyr55Asn
rsID: not shown
Zygosity: Het
Ref Allele: T
Alt Allele: A
Freq: not shown
REVEL: 0.581
Quality: Poor evidence of alternate allele
Read support: 2 ALT / 23 REF (depth 25; BAM depth 24)
Source coordinates: chr1:35888564-35888565
ClinVar: not shown

Gene: COMT
Consequence: Missense variant
Variant: c.259G>A
Protein: p.Glu87Lys
rsID: not shown
Zygosity: Het
Ref Allele: G
Alt Allele: A
Freq: not shown
REVEL: 0.451
Quality: Poor evidence of alternate allele
Read support: 2 ALT / 23 REF (depth 25; BAM depth 20)
Source coordinates: chr22:19962785-19962786
ClinVar: not shown

Gene: AR
Consequence: Missense variant
Variant: c.452C>T
Protein: p.Ala151Val
rsID: not shown
Zygosity: Het
Ref Allele: C
Alt Allele: T
Freq: not shown
REVEL: 0.372
Quality: Sufficient depth and allele counts
Read support: 2 ALT / 16 REF (depth 18; BAM depth 16)
Source coordinates: chrX:67545598-67545599
ClinVar: not shown

Gene: ABCC4
Consequence: Missense variant
Variant: c.542T>C
Protein: p.Leu181Pro
rsID: not shown
Zygosity: Het
Ref Allele: A
Alt Allele: G
Freq: not shown
REVEL: 0.942
Quality: Sufficient depth and allele counts
Read support: 5 ALT / 26 REF (depth 31; BAM depth 26)
Source coordinates: chr13:95210771-95210772
ClinVar: not shown

Gene: ABCB7
Consequence: Missense variant
Variant: c.1845_1851delinsGAGAATT
Protein: p.Val617Ile
rsID: not shown
Zygosity: Het
Ref Allele: TACTCTT
Alt Allele: AATTCTC
Freq: not shown
REVEL: not shown
Quality: Sufficient depth and allele counts
Read support: 3 ALT / 20 REF (depth 23; BAM depth 19)
Source coordinates: chrX:75062412-75062419
ClinVar: not shown

Gene: ABCB7
Consequence: Missense variant splice region variant
Variant: c.247G>A
Protein: p.Ala83Thr
rsID: not shown
Zygosity: Het
Ref Allele: C
Alt Allele: T
Freq: not shown
REVEL: 0.196
Quality: Sufficient depth and allele counts
Read support: 2 ALT / 10 REF (depth 12; BAM depth 11)
Source coordinates: chrX:75112972-75112973
ClinVar: not shown

Gene: TAF9
Consequence: Splice donor in non-canonical transcripts
Variant: c.-111+236dup
Protein: not shown
rsID: rs200123392
Zygosity: Het
Ref Allele: A
Alt Allele: AC
Freq: 0.8541% uncommon (popmax 1.64%)
REVEL: not shown
Quality: Sufficient depth and allele counts
Read support: 3 ALT / 24 REF (depth 27; BAM depth 37)
Source coordinates: chr5:69369226-69369227
ClinVar: not shown

Gene: HDAC9
Consequence: Missense in non-canonical transcripts
Variant: c.1467+6128_1467+6129delinsTC
Protein: not shown
rsID: rs386710892
Zygosity: Het
Ref Allele: CA
Alt Allele: TC
Freq: not shown
REVEL: not shown
Quality: Sufficient depth and allele counts
Read support: 19 ALT / 26 REF (depth 45; BAM depth 34)
Source coordinates: chr7:18654811-18654813
ClinVar: not shown

Gene: HDAC9
Consequence: Splice donor in non-canonical transcripts
Variant: c.1468-8170_1468-8169delinsTA
Protein: not shown
rsID: rs386710893
Zygosity: Het
Ref Allele: GT
Alt Allele: TA
Freq: not shown
REVEL: not shown
Quality: Sufficient depth and allele counts
Read support: 28 ALT / 12 REF (depth 40; BAM depth 37)
Source coordinates: chr7:18658043-18658045
ClinVar: not shown

I want to do the labs that Dr. Powers has mentioned, but I’ve held off on doing this testing for quite some time.

This is since a lot of the blood tests, including 3a-adg, cannot be found in my country Sweden. Ideally I’d like to do the DUTCH and blood tests on the same day to get the most useful results.

A 3a-ADG test can however be ordered through a private clinic in London (https://www.privatebloodtestslondon.co.uk/blood-test/androstanediol-glucuronide), which has made me consider traveling there to do it.

The blood tests in Dr. P:s document that I can find in my country are:

Free and total testosterone, DHT, E2 (Sensitive), LH, FSH, SHBG, Albumin, Androstenedione, 17-OHP, Progesterone, Cortisol, DHEA-S, Prolactin, ACTH, Bilirubin (total), Bilirubin (direct), AST, ALT, ALP, GGT, Bile acids (TBA), MMA, Creatinine, eGFR, Cystatin C, Homocysteine, Folate, Vitamin B12.

Some missing tests that can be found at the London clinic are:

3a-ADG, DHEA, E1, Pregnenolone, 11-Deoxycorticosterone, 11-Deoxycortisol, Vitamin B6.

My questions:

1. Is the 3a-ADG test interesting enough to warrant the trip?
2. If so, which of the London tests should I add to it, if any? Every test at that clinic seems to cost around £150 or more, so it quickly adds up. I’m thinking of adding DHT (for the ratio), pregnenolone, DHEA and DHEA-S, and maybe E1. I fit the first two phenotypes of the document.

Any help is greatly appreciated.

I wish more of the tests were available near me, including E1S, E2S, 11-oxo-androgens and 17-KS for instance.