r/genetics

Here is our story. Like everyone else we have went through NIPT carrier screening and everything came back low risk and we have no idea about expanded panel availability. Now the baby got delivered but baby has a rare genetic mutation causing Albinism. This is a surprise for us since none of our family histories has this kind of issue. We got to know that regular NIPT carrier screening will only look for life threatening, chromosomal abnormalities and some related Down syndrome conditions but nobody has mentioned about the expanded panel which includes around 250+ chromosomal and genetic carrier screening, also it doesn’t cost much extra, please check with Natera/obgyn. We had a miscarriage before but the obgyn doctor mentioned unless there are two miscarriages I won’t recommend extensive testing. I know albinism is very rare but my suggestion is to still get the expanded panel done.

Nobody wants a welcome a baby knowing baby will have issues for life, this is not just a life of the kid but lifetime prison for the parent growing that baby all along. Its better leave off that pain rather than bearing for life long seeing the kid grow with issues.

My another recommendation is to go for pre conceive counseling and carrier screening before you plan for pregnancy, discuss with your obgyn. Husband or wife might think if we go through expanded genetic screening and it might give you some problems which you might feel you are having fault in your partners eye , Yes that’s true but having a baby is a team play, both players have to give their best and run through life.

Hope my story helps someone getting rid of unhealthy pregnancy and move forward hoping for healthy one/ go for IVF instead.

#Albinism #Nipt

Hi. I hope this is an appropriate question for the sub.

My wife and I have three kids. The oldest is a teenager and had a medical emergency recently. A genetic test was done looking for specific findings, but it came back negative. Because the medical emergency could happen again and is typically life ending, doctors are doing a genome sequencing analysis. Our teenager, my wife, and I will give blood and the test will be done on all of us. If there is a finding in our teenager, then they will look at my wife and I's test for the same thing, otherwise my wife and I's tests will not be looked at.

The doctor wants to know if we want secondary findings. At first this sounded like a great thing, but he mentioned that with some findings, it can prevent people from getting life insurance or disability insurance. I assume it can also make health insurance more expensive, but not prevent someone from getting health insurance. I have read some people will get secondary findings and wish they had not because there is nothing they can do about the findings. We are struggling to decide how to address secondary findings, especially since this will effect our teenager.

I'm hoping to hear from some people in this sub with experience on what the positives and negatives are for learning secondary findings.

Hi everyone.

I am curious about DTC WGS. Sequencing is often suggested, though I notice that they have had controversies which I'm sure people are mostly already aware of. Recently they had controversy in how they presented research on hEDS.

I also find their pricing structure odd for custom packages. They charge $100 going from 10 to 20 reports, but then $300 going from 20 to 30 reports. They also seem to pretend that their prices are discounted. Do they ever charge the full price?

I don't know what their reports are like as they don't provide examples, and shipping is not as good for European customers.

I found tellmeGen are now offering WGS. They offer this at a cheaper price and they are in Europe. They have example reports though they appear limited. They do not provide specific genotype information for their "genetic vulnerability to health conditions" reports. It would be good to see specific information of relevant variants.

Sequencing has a genome explorer (not sure how useful that is), whereas tellmeGen does not. I'm not sure how easy it is to take the VCF file and search for specific SNPs or genes. The data could be uploaded to another site but ideally that should be avoided.

I notice tellmeGen uses the outdated GRCh37 reference genome. I'm not sure how much this matters in practice. Worst case, they provide the FASTQ file for reanalysis somewhere else if needed.

A red flag for me is how they have a spelling mistake on their front page with "encripted". I know they are a Spanish company but I'd expect a competent company to avoid English spelling errors on their front page.

I'm curious what people think.

Hey everyone. I've been wanting to know a lot about my health recently, after some blood tests and some health scares. I'm looking for a test that can tell me about a lot of detail and depth about my health. I'm not sure the difference between things like 23andme or nebula genomics or sequencing.com. I also want something that can check my gut microbiome, but ancestry is a good perk.

I took a documented gap in the human reference genome (chrY heterochromatin, GRCh38). Pulled the real DNA on both sides from UCSC. Used a Markov model to bridge the gap. Submitted the result to NCBI BLAST.

Zero matches. Not human, not primate, not anything in nt.

```

>GAIA_chrY_gap_fill | BLAST NOVEL

AGGCCTAGTGCTGGCTGTGTGTGTGCCTGTGCTCCAGGCTGGTCTCGAGCTCA

AGCAATCCTCCCACCTCAGCCTCCCAAGTAGCTGGGACCACAGGCGCGTGCCA

CCACGCCTGGCTAATTTTTGTATTTTTAGTAGAGACAGGGTTTCACCATGTTG

GCCAGGCTGGTCTCGAACTCCTGACCTCAAGTGATCTGCCCGCCTTGGCCTCC

CAAAGTGCTGGGATTACAGGCATGAGCCACCGCGCCCGGCC

```

44/44 gap fills tested. All NOVEL. 45.6 million bp total across 374 gaps.

Method: my own method i developed.

What am I missing? Roast me

So like...

My mom is white my dad is black so my skin is medium tan.

Also why do I have a brain like how is it that a certain gene combination always results in a brain?

Are there non essential genes and essential genes?

So, in my country we have a special degree that allows you to apply to a local medical school directly, and finish a BS/MD program (Bachelor of Science/Doctor of Medicine). But I've also got an option to directly do a Bachelor of Science degree in Molecular Biology.

My Dad says I should just do the Med School degree and specialize in genetic research later as a medical consultant, and is that the better option for the career I'm looking for? Or should I do a BS degree that directly relates to the subject I'm planning to research?

Does having a medical degree put you in a better position when applying to Master's degrees or PhDs abroad? And do you specifically learn how to write research papers and stuff in medical school that would give you the skills to spend a career in research?

I'm having a lot of trouble with this dilemma, and would really appreciate some advice.

This comes after research involving axoloti, zebra fish, and mice.

my mother was 44 when she had me, and my father was 53. will this affect my lifespan and health? im a teenager rn and i really want to live a long life but i have older parents and also t1d which does shorten my lifespan. im sorry if this is the wrong subreddit i just didnt know where to post and im really scared </3

https://preview.redd.it/s9usrkwcfj1h1.png?width=456&format=png&auto=webp&s=e420bb6235fd2f0e458cd71bab93e461b2d3fc87

https://preview.redd.it/n80etpeffj1h1.png?width=453&format=png&auto=webp&s=f510fb42b9c18f91d36ecad97a89dca98a485def

https://preview.redd.it/g9bo2enifj1h1.png?width=593&format=png&auto=webp&s=8f32fe7113b966025b28e7382ead12e7db833dd2

https://preview.redd.it/rz1wi78kfj1h1.png?width=494&format=png&auto=webp&s=0bc0d4bf3bf7c0b248255ccf55bd7d54758850d8

I'm a 2nd year undergrad biology student (3 year course in hungary, no idea what "upper division" means in the description, i hope the mods let this stay up! i'm very interested in genetics normally but for some reason i hit a wall with this one..)

I wonder if epigenetics could influence the likelihood of some mutations which might explain why some animals seem so well adapted to their environment

Has anyone ever used a personalized health service or lab test (e.g., DNA kits, microbiome testing, gi map tests, genetic tests, or comprehensive blood work)? Is it worth it? What was it like?

Figure I found so y'all know what I'm referring to

It's my understanding that usually, the Tn5 homodimer carries a continuous strand of transposon DNA flanked by the hyperactive Mosaic End recognition sequences(?) and then inserts this into dsDNA somewhere else. But I don't understand - and no one seems to have the answer - how: 1. they make these discontinuous in the first place, and 2. how they attach this single-stranded adaptor to the transfer strand (how do they know which one is the transfer strand as well???).

I genuinely can't tell if I'm being dense or if literally no one explains this anywhere.