Are there any adverse interactions between different kombucha brands?

I apologize if this is a naive question as I am new to this space and am interested in it because Health-Ade the kombucha drink has been helping me feel better mentally and physically.

I don’t want to mess up this progress by adding another live culture drink. I do understand that not all kombucha is the same yet have similar creation processes. I just wonder if different brands have different enough live cultures to have significant contrasting gut/health impacts.

The one that I want to try is GT Synergy.

reddit.com
u/thwoomfist — 2 days ago

Is it possible for a heterozygous autosomal recessive disease to exhibit varying levels of symptoms?

I ask because I came across anecdotal evidence of an autosomal recessive condition exhibiting symptoms despite 1 allele. It was eds. Now could something more serious like a POLG variant do the same?

reddit.com
u/thwoomfist — 13 days ago
▲ 1 r/MTHFR

What does this mean? (CTGGCGCGTCCCGCCCAGGTCTGGCGCGTCCCGCCCAGGT)

u/thwoomfist — 28 days ago

TRPM3

Does LDN work only if you have lower enzymatic activity of TRPM3? For example, genetic variants that encode for less or partially working TRPM3 enzymes

reddit.com
u/thwoomfist — 1 month ago
▲ 3 r/Nutrition_Healthy+1 crossposts

Vitamin E not toxic in high amounts?

"Despite concerns that have been expressed about possible health risks from high intake of vitamin E, a new review concludes that biological mechanisms exist to routinely eliminate excess levels of the vitamin, and they make it almost impossible to take a harmful amount."

Is this article from 2013 outdated or is vitamin E really not a concern if you take, say 2000mg?

https://news.oregonstate.edu/news/excess-vitamin-e-intake-not-health-concern

u/thwoomfist — 2 months ago

Has anyone taken vitamin e and aspirin close in time together?

If yes, how much of each and what was your experience of it?

I just realized that I bought aspirin and vitamin e around the same time, and since my memory has been so hazy lately, I can’t remember if I took them together or just around the same time. I am usually good at checking interactions between drugs, but tbh in the last couple years I have been uncharacteristically gullible and easily placed trust in strangers if I thought they knew what they were talking about. I saw vitamin e was good and aspirin was good, so I didn’t give it a deeper thought. I took 1500 mg of vitamin e (unique e gamma stuff) over a week in early August 2025. Aspirin I probably took a couple 325 mg tablets here and there between late July 2025 - late August 2025. Again my memory is hazy so these dates may not be accurate. I’m just kinda worried I got some bleeding in my brain without me knowing, even if it was slight.

reddit.com
u/thwoomfist — 2 months ago
▲ 2 r/DNA

Do radioactive elements such as Cesium-137 change the DNA?

Not sure if this is the right reddit for this, but if anyone can answer, thank you.

https://pubmed.ncbi.nlm.nih.gov/39302823/

"The A/J mice were compared with a control strain with the same origin ancestry (no Cesium-137 water) for DNA double-strand breaks (DSBs), oxidative stress, chromosome aberrations, micronucleus test results, whole genome analysis, carcinogenicity, tumor growth rate, and immune competence. Compared to the control group, DNA DSBs and oxidative stress were significantly increased in the Cesium-137 group. However, no significant differences were observed between the groups regarding chromosome aberration, micronuclei, or the whole genome sequence mutation analysis."

Does this mean the amount of Cesium-137 given to the A/J mice caused DNA damage to them, but it did not cause enough damage to affect the whole genome sequence?

Edit: Looking further into the study, I found that the total Cesium-137 in the mice was equivalent to 94,000 bq/kg in humans, far far more than the amount that I was curious about. So I think I found my answer: man-made radioactive elements like CS-137 are "safe" in extremely tiny amounts.

u/thwoomfist — 2 months ago

If DHT according to Dr. Peat does not cause male pattern baldness, then why does inhibiting 5AR which reduces DHT regrow hair?

Some possible reasons:

  • 5AR is not only responsible for DHT
  • 5ARIs like Finasteride do more than reduce 5AR (unlikely)
  • Genetics (highly likely); no matter how stressed some people get they don't get major hair loss that doesn't grow back, especially not at the level of male pattern baldness.

I don't think Dr. Peats views on this is correct imo; male pattern baldness is highly genetic, and is not caused by stress. So reversing mpb through relieving stress or thyroid optimization is not possible. Maybe slight regrowth around the hairline is normal by changing diet/lifestyle, but it's not significant. If anyone can provide evidence that mpb was reversed through peating, then please provide the proof.

reddit.com
u/thwoomfist — 2 months ago

What actually happens to the brain after neurofeedback?

What physical changes happen? Grey, white matter changes? Other changes to more permanent structures? Not very well versed in neuroscience so don’t know the structure of the brain much. All I know is some things can change and others not so much. 90% of the brain is grown by 5ish. Things like grey and white matter, myelination, conductivity, etc are more amenable. I’m guessing neurofeedback changes those? Can it make the brain bigger? How does it differ from other types of brain training in the way that it changes the brain?

reddit.com
u/thwoomfist — 3 months ago

Could this be some type of skin cancer?

(The redness is likely from me irritating the area around it because I just found the mark and was prodding with my finger to ascertain what it was. It is also scaly and flaky.)

Is this worrisome enough to see a doctor?

u/thwoomfist — 3 months ago
▲ 11 r/raypeat

I know the idea of healing the thyroid is to eat and lifestyle your way there, but what if the thyroid gland just doesn't physically work at all no matter what you try to fix it? In this state, would consuming pro metabolic substances be actually harmful? For example, hormone supplements high amounts of carbs vitamins minerals etc etc. What does the body do with those without sufficient thyroid hormone? Does it cause more damage than good?

Also is the idea of 'perceive think and act' a notion that in any damaged state of the body one can be able to find a new equilibrium of complete or near complete regeneration as long as you do (eat, lifestyle actions, thoughts) the right thing? If so, could this possibly be because the body enters a new bioelectric equilibrium from the new cell state, similar to how researchers are now able to regenerate body tissue in organisms using bioelectric 'tricks'?

reddit.com
u/thwoomfist — 3 months ago
▲ 18 r/raypeat

Heello Ray once wrote adults should feel youthful like they were as children. Do you find this to be true in your experience peating? Is your curiosity and excitement to absorb the environment around you and to experience novelty similar to when you were a kid? If yes what else would you say you have retained?

reddit.com
u/thwoomfist — 4 months ago

Is there reperfusion injury for sleep apneans when they start to fix their sleep? Reperfusion injury is when brain cells are reintroduced to oxygen too rapidly and ROS destroys the cells. Is this something to be worried about when allowing for less oxygen deprived nights? There are some things to help prevent it apparently - like eating citrus or other tangy fruits after a meal.

reddit.com
u/thwoomfist — 4 months ago